Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05071

HP ID(1) HP05071
Gene ID(2) 285958
Gene Symbol finder C7orf40
Protein Name chromosome 7 open reading frame 40
RefSeq NR_003697.1
Length of RefSeq (bp) 837
Chromosome 7p13
Reference DDBJ accession
UniGene Hs.25892

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe32F11 pKA1U5 AB371433 GAGACCTGTACTCCGTACTCCGTACTTCGTAGTCGCAGCGGCGCGGTCTTCGGCAGTTTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl