Prev. | 

RIKEN DNA Bank Human Resource - SNHG15

Gene ID NCBI Gene 285958 |  KEGG hsa:285958
Gene Symbol SNHG15
Protein Name small nucleolar RNA host gene 15
Synonyms C7orf40|Linc-Myo1g|MYO1GUT
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052931 ARe32F11 pKA1U5 NR_003697.1  
GAGACCTGTACTCCGTACTCCGTACTTCGTAGTCGCAGCGGCGCGGTCTTCGGCAGTTTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl