Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05066

HP ID(1) HP05066
Gene ID(2) 84988
Gene Symbol finder PPP1R16A
Protein Name protein phosphatase 1, regulatory (inhibitor) subunit 16A
RefSeq NM_032902.5
Length of RefSeq (bp) 2326
Chromosome 8q24.3
Reference DDBJ accession
UniGene Hs.521937

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe32C04 pKA1U5 GGGGCAGCAGGTGCCAACGGTCAGGAAAGGCAGGGAGCCGAAGGCTGCCGGTGGGCGCTT
ARi67D02 pGCAP10 GAGGTCCCGCCGGGCCGCCTTGGGCGTTGCTGGCTGAGGCCCAGGGCAGCAGGTGCCAAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl