Prev. |  KEGG KO K17458 > 

RIKEN DNA Bank Human Resource - PPP1R16A

Gene ID NCBI Gene 84988 |  KEGG hsa:84988
Gene Symbol PPP1R16A
Protein Name protein phosphatase 1 regulatory subunit 16A
Synonyms MYPT3
Ortholog resources KEGG ortholog (KEGG orthology K17458) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX037312 IRAK093E16 pCMV-SPORT6 BC049841 NM_032902 Full
HGY088246 IRAL020K06 pOTB7 BC007854 NM_032902 Full
HGY098801 IRAL047A01 pOTB7 BC053506 NM_032902

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098839 M01C047B15 pDONR221 MGC13-C08 BC007854 NM_032902  
HGE098887 M01C047D15 pDONR221 MGC13-C08 BC007854 NM_032902  
HGE098935 M01C047F15 pDONR221 MGC13-C08 BC007854 NM_032902  
HGE098983 M01C047H15 pDONR221 MGC13-C08 BC007854 NM_032902  
HGE099031 M01C047J15 pDONR221 MGC13-C08 BC007854 NM_032902  
HGE099079 M01C047L15 pDONR221 MGC13-C08 BC007854 NM_032902  
HGE099127 M01C047N15 pDONR221 MGC13-C08 BC007854 NM_032902  
HGE099175 M01C047P15 pDONR221 MGC13-C08 BC007854 NM_032902  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052852 ARe32C04 pKA1U5 NM_032902.5  
GGGGCAGCAGGTGCCAACGGTCAGGAAAGGCAGGGAGCCGAAGGCTGCCGGTGGGCGCTT
HKR186874 ARi67D02 pGCAP10 NM_032902.5  
GAGGTCCCGCCGGGCCGCCTTGGGCGTTGCTGGCTGAGGCCCAGGGCAGCAGGTGCCAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl