Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05054

HP ID(1) HP05054
Gene ID(2) 127281
Gene Symbol finder C1orf93
Protein Name chromosome 1 open reading frame 93
RefSeq NM_152371.2
Length of RefSeq (bp) 2725
Chromosome 1p36.32
Reference DDBJ accession
UniGene Hs.462033

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe31E01 pKA1U5 GGAGCGAGGAGCCGGGTAGCGGGGAACAGGGAGTCGGGGAGCCGGGAACCAGGGCTGGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl