Prev. |  KEGG KO K15717 > 

RIKEN DNA Bank Human Resource - PRXL2B

Gene ID NCBI Gene 127281 |  KEGG hsa:127281
Gene Symbol PRXL2B
Protein Name peroxiredoxin like 2B
Synonyms C1orf93|FAM213B
Ortholog resource in our bank

  PRXL2B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013019 IRAK032J03 pBluescriptR BC022547 NM_152371 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE080403 M01C001A03 pDONR221 04-134-2_1-A02 BC022547 ENST00000378425  
HGE080451 M01C001C03 pDONR221 04-134-2_1-A02 BC022547 ENST00000378425  
HGE080499 M01C001E03 pDONR221 04-134-2_1-A02 BC022547 ENST00000378425  
HGE080547 M01C001G03 pDONR221 04-134-2_1-A02 BC022547 ENST00000378425  
HGE080595 M01C001I03 pDONR221 04-134-2_1-A02 BC022547 ENST00000378425  
HGE080643 M01C001K03 pDONR221 04-134-2_1-A02 BC022547 ENST00000378425  
HGE080691 M01C001M03 pDONR221 04-134-2_1-A02 BC022547 ENST00000378425  
HGE080739 M01C001O03 pDONR221 04-134-2_1-A02 BC022547 ENST00000378425  
HGE089207 M01C023A07 pDONR221 MGC01-A04 BC022547 ENST00000378425  
HGE089255 M01C023C07 pDONR221 MGC01-A04 BC022547 ENST00000378425  
HGE089303 M01C023E07 pDONR221 MGC01-A04 BC022547 ENST00000378425  
HGE089351 M01C023G07 pDONR221 MGC01-A04 BC022547 ENST00000378425  
HGE089399 M01C023I07 pDONR221 MGC01-A04 BC022547 ENST00000378425  
HGE089447 M01C023K07 pDONR221 MGC01-A04 BC022547 ENST00000378425  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052497 ARe31E01 pKA1U5 NM_152371.2  
GGAGCGAGGAGCCGGGTAGCGGGGAACAGGGAGTCGGGGAGCCGGGAACCAGGGCTGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl