Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05038

HP ID(1) HP05038
Gene ID(2) 25983
Gene Symbol finder NGDN
Protein Name neuroguidin, EIF4E binding protein
RefSeq NM_015514.1
Length of RefSeq (bp) 1588
Chromosome 14q11.2
Reference DDBJ accession
UniGene Hs.9043

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe30A03 pKA1U5 AAGGGGCTTTGCGAAGATGGCGGCGCTGGGGGTGCTGGAGTCCGACCTGCCAAGTGCCGT
RBb40H08 pGCAP1 GGGGCTTTGCGAAGATGGCGGCGCTGGGGGTGCTGGAGTCCGACCTGCCAAGTGCCGTGA
RBd38F05 pGCAP10 GGGGCTTTGCGAAGATGGCGGCGCTGGGGGTGCTGGAGTCCGACCTGCCAAGTGCCGTGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl