Prev. |  KEGG KO K14765 > 

RIKEN DNA Bank Human Resource - NGDN

Gene ID NCBI Gene 25983 |  KEGG hsa:25983
Gene Symbol NGDN
Protein Name neuroguidin
Synonyms C14orf120|CANu1|LCP5|NGD|lpd-2
Ortholog resource in our bank

  NGDN

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY095085 IRAL037L21 pDNR-LIB BC030817 XM_945159 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096835 M01C042B11 pDONR221 MGC10-G06 BC030817 XM_033371  
HGE096883 M01C042D11 pDONR221 MGC10-G06 BC030817 XM_033371  
HGE096931 M01C042F11 pDONR221 MGC10-G06 BC030817 XM_033371  
HGE096979 M01C042H11 pDONR221 MGC10-G06 BC030817 XM_033371  
HGE097027 M01C042J11 pDONR221 MGC10-G06 BC030817 XM_033371  
HGE097075 M01C042L11 pDONR221 MGC10-G06 BC030817 XM_033371  
HGE097123 M01C042N11 pDONR221 MGC10-G06 BC030817 XM_033371  
HGE097171 M01C042P11 pDONR221 MGC10-G06 BC030817 XM_033371  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052003 ARe30A03 pKA1U5 NM_015514.1  
AAGGGGCTTTGCGAAGATGGCGGCGCTGGGGGTGCTGGAGTCCGACCTGCCAAGTGCCGT
HKR336176 RBb40H08 pGCAP1 NM_015514.1  
GGGGCTTTGCGAAGATGGCGGCGCTGGGGGTGCTGGAGTCCGACCTGCCAAGTGCCGTGA
HKR375325 RBd38F05 pGCAP10 NM_015514.1  
GGGGCTTTGCGAAGATGGCGGCGCTGGGGGTGCTGGAGTCCGACCTGCCAAGTGCCGTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl