Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NGDN

Gene ID (NCBI) 25983
Gene Symbol NGDN
Protein Name neuroguidin, EIF4E binding protein
Synonyms C14orf120|LCP5|NGD|lpd-2
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY095085 IRAL037L21 pDNR-LIB BC030817 XM_945159 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096835 M01C042B11 pDONR221 MGC10-G06 BC030817 XM_033371  
HGE096883 M01C042D11 pDONR221 MGC10-G06 BC030817 XM_033371  
HGE096931 M01C042F11 pDONR221 MGC10-G06 BC030817 XM_033371  
HGE096979 M01C042H11 pDONR221 MGC10-G06 BC030817 XM_033371  
HGE097027 M01C042J11 pDONR221 MGC10-G06 BC030817 XM_033371  
HGE097075 M01C042L11 pDONR221 MGC10-G06 BC030817 XM_033371  
HGE097123 M01C042N11 pDONR221 MGC10-G06 BC030817 XM_033371  
HGE097171 M01C042P11 pDONR221 MGC10-G06 BC030817 XM_033371  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052003 ARe30A03 pKA1U5 NM_015514.1  
AAGGGGCTTTGCGAAGATGGCGGCGCTGGGGGTGCTGGAGTCCGACCTGCCAAGTGCCGT
HKR375325 RBd38F05 pGCAP10 NM_015514.1  
GGGGCTTTGCGAAGATGGCGGCGCTGGGGGTGCTGGAGTCCGACCTGCCAAGTGCCGTGA
HKR336176 RBb40H08 pGCAP1 NM_015514.1  
GGGGCTTTGCGAAGATGGCGGCGCTGGGGGTGCTGGAGTCCGACCTGCCAAGTGCCGTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.01.19

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl