Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05026

HP ID(1) HP05026
Gene ID(2) 10848
Gene Symbol finder PPP1R13L
Protein Name protein phosphatase 1, regulatory (inhibitor) subunit 13 like
RefSeq NM_006663.3
Length of RefSeq (bp) 3120
Chromosome 19q13.32
Reference DDBJ accession
UniGene Hs.466937

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe28F12 pKA1U5 GACCCCTTCTCCCCAGGTGGGAGAGGCTTTCCAGAGCGGAGGGAGGGTCAAGGGGAAGGG
ARe82E07 pKA1U5 GCCTGCCCCGCCCCGNTTCTCCGCTCCCCAAGCCGGAGCCCGAGCTGGAGGAAGCCCCCA
ARi25G08 pGCAP10 GGTTCTCCGCTCCCCAAGCCGGAGCCCGAGCTGGAGGAAGCCCCCAGGTGCCAGGATCTG
ARi37A03 pGCAP10 GAAGCCTTAAAGAGACAGGACGGTCGATTGGTCTGAAATTCTTGAAGAGACAGGCGCCCG
ARi47C07 pGCAP10 GAAGCCTTAAAGAGACAGGACGGTCGATTGGTCTGAAATTCTTGAAGAGACAGGCGCCCG
RBd89D04 pGCAP10 GAAGCCTTAAAGAGACAGGACGGTCGATTGGTCTGAAATTCTTGAAGAGACAGGCGCCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl