Prev. | 

RIKEN DNA Bank Human Resource - PPP1R13L

Gene ID NCBI Gene 10848 |  KEGG hsa:10848
Gene Symbol PPP1R13L
Protein Name protein phosphatase 1 regulatory subunit 13 like
Synonyms IASPP|NKIP1|RAI|RAI4
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010986 IRAK027H18 pCMV-SPORT6 BC020589 NM_006663 Partial
HGX056149 IRAK140G05 pCMV-SPORT6 BC064913 NM_006663 Full/var
HGY081973 IRAL004P13 pOTB7 BC001475 NM_006663 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051332 ARe28F12 pKA1U5 NM_006663.3  
GACCCCTTCTCCCCAGGTGGGAGAGGCTTTCCAGAGCGGAGGGAGGGTCAAGGGGAAGGG
HKR072903 ARe82E07 pKA1U5 NM_006663.3  
GCCTGCCCCGCCCCGNTTCTCCGCTCCCCAAGCCGGAGCCCGAGCTGGAGGAAGCCCCCA
HKR170152 ARi25G08 pGCAP10 NM_006663.3  
GGTTCTCCGCTCCCCAAGCCGGAGCCCGAGCTGGAGGAAGCCCCCAGGTGCCAGGATCTG
HKR174803 ARi37A03 pGCAP10 NM_006663.3  
GAAGCCTTAAAGAGACAGGACGGTCGATTGGTCTGAAATTCTTGAAGAGACAGGCGCCCG
HKR178855 ARi47C07 pGCAP10 NM_006663.3  
GAAGCCTTAAAGAGACAGGACGGTCGATTGGTCTGAAATTCTTGAAGAGACAGGCGCCCG
HKR395676 RBd89D04 pGCAP10 NM_006663.3  
GAAGCCTTAAAGAGACAGGACGGTCGATTGGTCTGAAATTCTTGAAGAGACAGGCGCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl