Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05025

HP ID(1) HP05025
Gene ID(2) 90102
Gene Symbol finder PHLDB2
Protein Name pleckstrin homology-like domain, family B, member 2
RefSeq NM_145753.2
Length of RefSeq (bp) 6015
Chromosome 3q13.2
Reference DDBJ accession
UniGene Hs.477114

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe28F08 pKA1U5 GAGGCGCTAGGGCGGCGGCGCCAGCGTAGAGCGGCGGTTTGGAGGAAAGATGAGACGATT
ARe36G08 pKA1U5 TGGAGAAGCTGGCGCCCAGTGATGGGGCAAACAGCCATGCCCTTCCAGCAGCCGTGAAAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl