Prev. | 

RIKEN DNA Bank Human Resource - PHLDB2

Gene ID NCBI Gene 90102 |  KEGG hsa:90102
Gene Symbol PHLDB2
Protein Name pleckstrin homology like domain family B member 2
Synonyms LL5b|LL5beta
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY094116 IRAL035E20 pDNR-LIB BC022383 NM_145753 Partial/var
HGY096779 IRAL041P19 pDNR-LIB BC031000 NM_145753 Partial
HGY101902 IRAL054M14 pOTB7 BC069194 NM_145753 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051328 ARe28F08 pKA1U5 NM_145753.2  
GAGGCGCTAGGGCGGCGGCGCCAGCGTAGAGCGGCGGTTTGGAGGAAAGATGAGACGATT
HKR054552 ARe36G08 pKA1U5 NM_145753.2  
TGGAGAAGCTGGCGCCCAGTGATGGGGCAAACAGCCATGCCCTTCCAGCAGCCGTGAAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl