Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05020

HP ID(1) HP05020
Gene ID(2) 10906
Gene Symbol finder TRAFD1
Protein Name TRAF-type zinc finger domain containing 1
RefSeq NM_006700.1
Length of RefSeq (bp) 2618
Chromosome 12q
Reference DDBJ accession
UniGene Hs.5148

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe28D02 pKA1U5 GAGAGGAGGCTCCGTGTCTGCAGCTAGTGTGTCAACTCAGCGTTTCTCCTCTCGTCCCTG
RBd10B04 pGCAP10 GGTTGTTCAGTGCGGGGTCTGACAGAGGAGGCTCCGTGTCTGCAGCTAGTGTGTCAACTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl