Prev. | 

RIKEN DNA Bank Human Resource - TRAFD1

Gene ID NCBI Gene 10906 |  KEGG hsa:10906
Gene Symbol TRAFD1
Protein Name TRAF-type zinc finger domain containing 1
Synonyms FLN29
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051274 ARe28D02 pKA1U5 NM_006700.1  
GAGAGGAGGCTCCGTGTCTGCAGCTAGTGTGTCAACTCAGCGTTTCTCCTCTCGTCCCTG
HKR364028 RBd10B04 pGCAP10 NM_006700.1  
GGTTGTTCAGTGCGGGGTCTGACAGAGGAGGCTCCGTGTCTGCAGCTAGTGTGTCAACTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl