Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05013

HP ID(1) HP05013
Gene ID(2) 23760
Gene Symbol finder PITPNB
Protein Name phosphotidylinositol transfer protein, beta
RefSeq NM_012399.3
Length of RefSeq (bp) 2941
Chromosome 22q12.1
Reference DDBJ accession
UniGene Hs.713581

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe27H10 pKA1U5 GATCGGCGGCNGCGGCNGCGGTATCGGCGGCCNCTTNTGAGGGGGTTCCGGGAAGATGGT
ARiS122L13 pGCAP10 GGANNCGGTAGCGGCGGCGGCGGCGGTGGTATCGGCGGCAGCTGTGAGGGGGTTCCGGGA
RBb19A02 pKA1U5 GGGTAGCGGCGGCGGCGGCGGTGGTATCGGCGGCAGCTGTGAGGGGGTTCCGGGAAGATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl