Prev. | 

RIKEN DNA Bank Human Resource - PITPNB

Gene ID NCBI Gene 23760 |  KEGG hsa:23760
Gene Symbol PITPNB
Protein Name phosphatidylinositol transfer protein beta
Synonyms PI-TP-beta|PtdInsTP|VIB1B
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010640 IRAK026J24 pCMV-SPORT6 BC031427 NM_012399 Partial/var
HGY091868 IRAL029L04 pOTB7 BC018704 NM_012399 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050978 ARe27H10 pKA1U5 NM_012399.3  
GATCGGCGGCNGCGGCNGCGGTATCGGCGGCCNCTTNTGAGGGGGTTCCGGGAAGATGGT
HKR249077 ARiS122L13 pGCAP10 NM_012399.3  
GGANNCGGTAGCGGCGGCGGCGGCGGTGGTATCGGCGGCAGCTGTGAGGGGGTTCCGGGA
HKR327602 RBb19A02 pKA1U5 NM_012399.3  
GGGTAGCGGCGGCGGCGGCGGTGGTATCGGCGGCAGCTGTGAGGGGGTTCCGGGAAGATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl