Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05004

HP ID(1) HP05004
Gene ID(2) 10054
Gene Symbol finder UBA2
Protein Name ubiquitin-like modifier activating enzyme 2
RefSeq NM_005499.2
Length of RefSeq (bp) 2682
Chromosome 19q12
Reference DDBJ accession
UniGene Hs.631580

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe27A04 pKA1U5 GTCCGCCTCCGCCGCGGCTCGTGGTTGTCCCGCCATGGCACTGTCGCGGGGGCTGCCCCG
ARe47A05 pKA1U5 GGCCCTTCCCCCACCCGCTTCCGGCCGCGGCTCGGTTCTCCCGCCTCCGCCTCCGCCGCG
ARiS020I15 pGCAP10 GAGGCCNNNNTTCCCCCACCCGCTTCCGGCCGCGGCTCGGTTCTCCCGCCTCCGCCTCCG
ARiS045O04 pGCAP10 GGCGGCTCGGTTCTCCCGCCTCCGCCTCCNCCGCGGCTCGTGGTTGTCCCGCCATGGCAC
ARiS194C16 pGCAP10 GCTTCCCCCACCCGCTTCCGGCCGCGGCTCGGTTCTCCCGCCTCCGCCTCCGCCGCGGCT
RBb31E01 pGCAP1 TGGCTTCCGGCCGCGGCTCGGTTCTCCCGCCTCCGCCTCCGCCGCGGCTCGTGGTTGTCC
RBb60H07 pGCAP1 GCCCCCGCCTCCGCCTCCGCCGCGGCTCGTGGTTGTCCCGCCATGGCACTGTCGCGGGGG
RBd15H08 pGCAP10 GGCCTCCGCCGCGGCTCGTGGTTGTCCCGCCATGGCACTGTCGCGGGGGCTGCCCCGGGA
RBd66E04 pGCAP10 GTGGAGAATGGCGTGAACCCCAGGGGGCGGAGCCTGCAGTGAGCCGAGATTGCGCCACTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl