Prev. |  KEGG KO K10685 > 

RIKEN DNA Bank Human Resource - UBA2

Gene ID NCBI Gene 10054 |  KEGG hsa:10054
Gene Symbol UBA2
Protein Name ubiquitin like modifier activating enzyme 2
Synonyms ARX|HRIHFB2115|SAE2
Ortholog resources KEGG ortholog (KEGG orthology K10685) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083628 IRAL009B04 pOTB7 BC003153 NM_005499 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050804 ARe27A04 pKA1U5 NM_005499.2  
GTCCGCCTCCGCCGCGGCTCGTGGTTGTCCCGCCATGGCACTGTCGCGGGGGCTGCCCCG
HKR058805 ARe47A05 pKA1U5 NM_005499.2  
GGCCCTTCCCCCACCCGCTTCCGGCCGCGGCTCGGTTCTCCCGCCTCCGCCTCCGCCGCG
HKR208207 ARiS020I15 pGCAP10 NM_005499.2  
GAGGCCNNNNTTCCCCCACCCGCTTCCGGCCGCGGCTCGGTTCTCCCGCCTCCGCCTCCG
HKR218340 ARiS045O04 pGCAP10 NM_005499.2  
GGCGGCTCGGTTCTCCCGCCTCCGCCTCCNCCGCGGCTCGTGGTTGTCCCGCCATGGCAC
HKR277664 ARiS194C16 pGCAP10 NM_005499.2  
GCTTCCCCCACCCGCTTCCGGCCGCGGCTCGGTTCTCCCGCCTCCGCCTCCGCCGCGGCT
HKR332497 RBb31E01 pGCAP1 NM_005499.2  
TGGCTTCCGGCCGCGGCTCGGTTCTCCCGCCTCCGCCTCCGCCGCGGCTCGTGGTTGTCC
HKR344175 RBb60H07 pGCAP1 NM_005499.2  
GCCCCCGCCTCCGCCTCCGCCGCGGCTCGTGGTTGTCCCGCCATGGCACTGTCGCGGGGG
HKR366176 RBd15H08 pGCAP10 NM_005499.2  
GGCCTCCGCCGCGGCTCGTGGTTGTCCCGCCATGGCACTGTCGCGGGGGCTGCCCCGGGA
HKR386500 RBd66E04 pGCAP10 NM_005499.2  
GTGGAGAATGGCGTGAACCCCAGGGGGCGGAGCCTGCAGTGAGCCGAGATTGCGCCACTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl