Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05001

HP ID(1) HP05001
Gene ID(2) 5834
Gene Symbol finder PYGB
Protein Name phosphorylase, glycogen; brain
RefSeq NM_002862.3
Length of RefSeq (bp) 4131
Chromosome 20p11.2-p11.1
Reference DDBJ accession
UniGene Hs.368157

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe26G09 pKA1U5 CCATCCCGTCCGCAGAGCCGCAGTGCCGGGCGCCAGAGCAGCGGCGCCAGAGCAGCTGCA
ARi63A04 pGCAP10 GACACGGTGCGCGACCACCTCGTGGGCCGCTGGATCCGCACGCAGCAGCACTACTACGAG
RBb69E06 pGCAP1 ACCGCAATGTGGCCACGCCCCGCGACTACTTCTTCGCGCTGGCGCACACGGTGCGCGACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl