Prev. |  KEGG KO K00688 > 

RIKEN DNA Bank Human Resource - PYGB

Gene ID NCBI Gene 5834 |  KEGG hsa:5834
Gene Symbol PYGB
Protein Name glycogen phosphorylase B
Synonyms GPBB
Ortholog resource in our bank

  PYGB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005629 IRAK014B05 pCMV-SPORT6 BC017045 NM_002862 Full
HGX009171 IRAK022P11 pCMV-SPORT6 BC030795 NM_002862 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050553 ARe26G09 pKA1U5 NM_002862.3  
CCATCCCGTCCGCAGAGCCGCAGTGCCGGGCGCCAGAGCAGCGGCGCCAGAGCAGCTGCA
HKR185204 ARi63A04 pGCAP10 NM_002862.3  
GACACGGTGCGCGACCACCTCGTGGGCCGCTGGATCCGCACGCAGCAGCACTACTACGAG
HKR347702 RBb69E06 pGCAP1 NM_002862.3  
ACCGCAATGTGGCCACGCCCCGCGACTACTTCTTCGCGCTGGCGCACACGGTGCGCGACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl