Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04997

HP ID(1) HP04997
Gene ID(2) 10424
Gene Symbol finder PGRMC2
Protein Name progesterone receptor membrane component 2
RefSeq NM_006320.2
Length of RefSeq (bp) 1873
Chromosome 4q26
Reference DDBJ accession
UniGene Hs.507910

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe26D04 pKA1U5 GGAGGAAGGCGCTGGCGGGCAGTGATGGCGGCTGGTGATGGGGACGTGAAGCTAGGCACC
ARe36H05 pKA1U5 TGGAGGAAGGCGCTGGCGGGCAGTGATGGCGNCTNTTGATGGGGACGTGAAGCTAGGCAC
ARe56G01 pKA1U5 GGCTGGCGGGCAGTGATGGCGGCTGGTGATGNCCCANNATGAAGCTAGGCACCCTGGGGA
ARe67E01 pKA1U5 GGCGCTGGCGGGCAGTGATGGCGGCTGGTGATCGTTTACGCTGAAGCTAGGCACCCTGGG
ARi07F09 pGCAP10 GAGTGATGGCGGCTGGTGATGGGGACGTGAAGCTAGGCACCCTGGGGAGTGGCAGCGAGA
ARi37D01 pGCAP10 GGGCGGGCAGTGATGGCGGCTGGTGATGGGGACGTGAAGCTAGGCACCCTGGGGAGTGGC
ARi48B11 pGCAP10 GGGCGGGCAGTGATGGCGGCTGGTGATGGGGACGTGAAGCTAGGCACCCTGGGGAGTGGC
RBd93G12 pGCAP10 GGAGGAAGGCGCTGGCGGGCAGTGATGGCGGCTGGTGATGGGGACGTGAAGCTAGGCACC
RBdS015C02 pGCAP10 GGGCGGGCAGTGATGGCGGCTGGTGATGGGGACGTGAAGCTAGGCACCCTGGGGAGTGGC
RBdS110H19 pGCAP10 GGGGGGCGGGGAGGAGGAGGAAGGCGCTGGCGGGCAGNGATGGCGGCTGGTGATGNGGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl