Prev. |  KEGG KO K17278 > 

RIKEN DNA Bank Human Resource - PGRMC2

Gene ID NCBI Gene 10424 |  KEGG hsa:10424
Gene Symbol PGRMC2
Protein Name progesterone receptor membrane component 2
Synonyms DG6|PMBP
Ortholog resource in our bank

  PGRMC2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093161 IRAL032P01 pDNR-LIB BC016692 NM_006320 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021358 W01A053G14 pENTR-TOPO IRAL032P01 BC016692 NM_006320  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050476 ARe26D04 pKA1U5 NM_006320.2  
GGAGGAAGGCGCTGGCGGGCAGTGATGGCGGCTGGTGATGGGGACGTGAAGCTAGGCACC
HKR054573 ARe36H05 pKA1U5 NM_006320.2  
TGGAGGAAGGCGCTGGCGGGCAGTGATGGCGNCTNTTGATGGGGACGTGAAGCTAGGCAC
HKR062545 ARe56G01 pKA1U5 NM_006320.2  
GGCTGGCGGGCAGTGATGGCGGCTGGTGATGNCCCANNATGAAGCTAGGCACCCTGGGGA
HKR066897 ARe67E01 pKA1U5 NM_006320.2  
GGCGCTGGCGGGCAGTGATGGCGGCTGGTGATCGTTTACGCTGAAGCTAGGCACCCTGGG
HKR162929 ARi07F09 pGCAP10 NM_006320.2  
GAGTGATGGCGGCTGGTGATGGGGACGTGAAGCTAGGCACCCTGGGGAGTGGCAGCGAGA
HKR174873 ARi37D01 pGCAP10 NM_006320.2  
GGGCGGGCAGTGATGGCGGCTGGTGATGGGGACGTGAAGCTAGGCACCCTGGGGAGTGGC
HKR179235 ARi48B11 pGCAP10 NM_006320.2  
GGGCGGGCAGTGATGGCGGCTGGTGATGGGGACGTGAAGCTAGGCACCCTGGGGAGTGGC
HKR397356 RBd93G12 pGCAP10 NM_006320.2  
GGAGGAAGGCGCTGGCGGGCAGTGATGGCGGCTGGTGATGGGGACGTGAAGCTAGGCACC
HKR406050 RBdS015C02 pGCAP10 NM_006320.2  
GGGCGGGCAGTGATGGCGGCTGGTGATGGGGACGTGAAGCTAGGCACCCTGGGGAGTGGC
HKR444187 RBdS110H19 pGCAP10 NM_006320.2  
GGGGGGCGGGGAGGAGGAGGAAGGCGCTGGCGGGCAGNGATGGCGGCTGGTGATGNGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl