Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04982

HP ID(1) HP04982
Gene ID(2) 283237
Gene Symbol finder TTC9C
Protein Name tetratricopeptide repeat domain 9C
RefSeq NM_173810.3
Length of RefSeq (bp) 1156
Chromosome 11q12.3
Reference DDBJ accession
UniGene Hs.31704

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe25D04 pKA1U5 GAGTGTCCCAGGCGTTCTCACGCCCGCAACAATTCCTGAGTAGGGCCTTGCTTGAGTTCT
RBb49H04 pGCAP1 GGTTCTCACGCCCGCAACAATTCCTGAGTAGGGCCTTGCTTGAGTTCTTCGGAAAGTCTC
RBd05G09 pGCAP10 GCCTTTCCTCTCCTTGCTCCTGCTGGTAAACCGAAGCCCAGGAGACTTCCAGTTCCGCAA
RBd63A03 pGCAP10 GGTTCTCACGCCCGCAACAATTCCTGAGTAGGGCCTTGCTTGAGTTCTTCGGAAAGTCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl