Prev. | 

RIKEN DNA Bank Human Resource - TTC9C

Gene ID NCBI Gene 283237 |  KEGG hsa:283237
Gene Symbol TTC9C
Protein Name tetratricopeptide repeat domain 9C
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046265 IRAK115L01 pCMV-SPORT6 BC053665 NM_173810 Full
HGY095762 IRAL039G18 pOTB7 BC032123 NM_173810

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050076 ARe25D04 pKA1U5 NM_173810.3  
GAGTGTCCCAGGCGTTCTCACGCCCGCAACAATTCCTGAGTAGGGCCTTGCTTGAGTTCT
HKR339772 RBb49H04 pGCAP1 NM_173810.3  
GGTTCTCACGCCCGCAACAATTCCTGAGTAGGGCCTTGCTTGAGTTCTTCGGAAAGTCTC
HKR362153 RBd05G09 pGCAP10 NM_173810.3  
GCCTTTCCTCTCCTTGCTCCTGCTGGTAAACCGAAGCCCAGGAGACTTCCAGTTCCGCAA
HKR385203 RBd63A03 pGCAP10 NM_173810.3  
GGTTCTCACGCCCGCAACAATTCCTGAGTAGGGCCTTGCTTGAGTTCTTCGGAAAGTCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl