Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04979

HP ID(1) HP04979
Gene ID(2) 26000
Gene Symbol finder TBC1D10B
Protein Name TBC1 domain family, member 10B
RefSeq NM_015527.3
Length of RefSeq (bp) 3326
Chromosome 16p11.2
Reference DDBJ accession
UniGene Hs.632182

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe25C01 pKA1U5 GTCGGCTGGCCTCGCCGGGAGGCCCGAGGGGCGGCGCCTTCTGCGGCCTCCCCGGCGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl