Prev. |  KEGG KO K19944 > 

RIKEN DNA Bank Human Resource - TBC1D10B

Gene ID NCBI Gene 26000 |  KEGG hsa:26000
Gene Symbol TBC1D10B
Protein Name TBC1 domain family member 10B
Synonyms EPI64B|FP2461
Ortholog resource in our bank

  TBC1D10B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB14995 pEGFP-C1-human TBC1D10B Expression vector of human TBC1 domain family member 10B (TBC1D10B), fused with N-terminal EGFP, CMV promoter.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX042933 IRAK107F13 pCMV-SPORT6 BC050523 NM_015527 Partial
HGX069900 IRAK174M12 pCMV-SPORT6 BC072453 NM_015527 Full
HGY100766 IRAL051P06 pDNR-LIB BC063112 NM_015527 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050049 ARe25C01 pKA1U5 NM_015527.3  
GTCGGCTGGCCTCGCCGGGAGGCCCGAGGGGCGGCGCCTTCTGCGGCCTCCCCGGCGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2023.04.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl