Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04972

HP ID(1) HP04972
Gene ID(2) 5289
Gene Symbol finder PIK3C3
Protein Name phosphoinositide-3-kinase, class 3
RefSeq NM_002647.2
Length of RefSeq (bp) 3083
Chromosome 18q12.3
Reference DDBJ accession
UniGene Hs.464971

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe24F05 pKA1U5 GCCCGCCTGCTAGGTGGTACCTTTGCAGACGGTGCGCATGGGGGAAGCAGAGAAGTTTCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl