RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - PIK3C3

Gene ID	NCBI Gene 5289 \| KEGG hsa:5289
Gene Symbol	PIK3C3
Protein Name	phosphatidylinositol 3-kinase catalytic subunit type 3
Synonyms	VPS34\|Vps34\|hVps34
Featured content	Autophagy (human)

Ortholog resource in our bank

  PIK3C3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB19633	pMXs-puro-VPS34-GFP	Retroviral vector for stable expression of human VPS34 with C-terminal EGFP.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY013324	IRAK033F04	pBluescriptR	BC033004	NM_002647	Full
HGX046141	IRAK115F21	pCMV-SPORT6	BC053651	NM_002647	Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR049725	ARe24F05	pKA1U5	NM_002647.2
HKR049725	GCCCGCCTGCTAGGTGGTACCTTTGCAGACGGTGCGCATGGGGGAAGCAGAGAAGTTTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl