Prev. |  KEGG KO K00914 > 

RIKEN DNA Bank Human Resource - PIK3C3

Gene ID NCBI Gene 5289 |  KEGG hsa:5289
Gene Symbol PIK3C3
Protein Name phosphatidylinositol 3-kinase catalytic subunit type 3
Synonyms VPS34|Vps34|hVps34
Ortholog resources KEGG ortholog (KEGG orthology K00914) in the DNA Bank
Featured content Autophagy (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY013324 IRAK033F04 pBluescriptR BC033004 NM_002647 Full
HGX046141 IRAK115F21 pCMV-SPORT6 BC053651 NM_002647 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049725 ARe24F05 pKA1U5 NM_002647.2  
GCCCGCCTGCTAGGTGGTACCTTTGCAGACGGTGCGCATGGGGGAAGCAGAGAAGTTTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl