Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04948

HP ID(1) HP04948
Gene ID(2) 7042
Gene Symbol finder TGFB2
Protein Name transforming growth factor, beta 2
RefSeq NM_003238.2
Length of RefSeq (bp) 5167
Chromosome 1q41
Reference DDBJ accession
UniGene Hs.133379

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe22H03 pKA1U5 GACACGTGTGCGCTTCTCTGCTCCGGAGCTGCTGCTGCTCCTGCTCTCAGCGCCGCAGTG
ARi50B07 pGCAP10 TGGATGTTATCTGCTGGCAGCAGAAGGTTCGCTCCGAGCGGAGCTCCAGAAGCTCCTGAC
ARiS191F23 pGCAP10 GTTTTTTTGGCCGGAGGAGCCGAGTTCAGATCCGCCACTCCGCACCCGAGACTGACACAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl