Prev. |  KEGG KO K13376 > 

RIKEN DNA Bank Human Resource - TGFB2

Gene ID NCBI Gene 7042 |  KEGG hsa:7042
Gene Symbol TGFB2
Protein Name transforming growth factor beta 2
Synonyms G-TSF|LDS4|TGF-beta2
Featured content Hippo signaling (human)
Featured content Endocytosis (human)
Ortholog resource in our bank

  TGFB2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048971 ARe22H03 pKA1U5 NM_003238.2  
GACACGTGTGCGCTTCTCTGCTCCGGAGCTGCTGCTGCTCCTGCTCTCAGCGCCGCAGTG
HKR180031 ARi50B07 pGCAP10 NM_003238.2  
TGGATGTTATCTGCTGGCAGCAGAAGGTTCGCTCCGAGCGGAGCTCCAGAAGCTCCTGAC
HKR276543 ARiS191F23 pGCAP10 NM_003238.2  
GTTTTTTTGGCCGGAGGAGCCGAGTTCAGATCCGCCACTCCGCACCCGAGACTGACACAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl