Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04947

HP ID(1) HP04947
Gene ID(2) 5578
Gene Symbol finder PRKCA
Protein Name protein kinase C, alpha
RefSeq NM_002737.2
Length of RefSeq (bp) 8787
Chromosome 17q22-q23.2
Reference DDBJ accession
UniGene Hs.531704

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe22H01 pKA1U5 GCTCTGCCGCCGCGAGTAGGAAGCGCGAGCGCCGGNCACCGGGCTGTCAGTGAGCCTGGG
RBdS081A22 pGCAP10 GAGTGAGCCTGGGGCCAGCGGGCGAGCCAGCGGCTCCGGCTCCCGCTCCCGCTCCGCGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl