Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PRKCA

Gene ID (NCBI) 5578
Gene Symbol PRKCA
Protein Name protein kinase C alpha
Synonyms AAG6|PKC-alpha|PKCA|PRKACA
Databases KEGG hsa:5578 |  NCBI Gene 5578
Featured content Wnt signaling pathway (human)
Featured content Sphingolipid signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Axon guidance - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02677)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY099109 IRAL047M21 pOTB7 BC053321 NM_002737 Partial
HGY100474 IRAL051D02 pDNR-LIB BC062759 NM_002737

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048969 ARe22H01 pKA1U5 NM_002737.2  
GCTCTGCCGCCGCGAGTAGGAAGCGCGAGCGCCGGNCACCGGGCTGTCAGTGAGCCTGGG
HKR432422 RBdS081A22 pGCAP10 NM_002737.2  
GAGTGAGCCTGGGGCCAGCGGGCGAGCCAGCGGCTCCGGCTCCCGCTCCCGCTCCGCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.02.22

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl