Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04926

HP ID(1) HP04926
Gene ID(2) 171568
Gene Symbol finder POLR3H
Protein Name polymerase (RNA) III (DNA directed) polypeptide H (22.9kD)
RefSeq NM_138338.2
Length of RefSeq (bp) 4159
Chromosome 22q13.2
Reference DDBJ accession
UniGene Hs.712617

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe21E09 pKA1U5 GGCCCGCAGTCGCGCAAGCGCGAGCGGCTGTGCGCGGTGCGCGGTGCGCGGTGCGTGGTG
ARe47G07 pKA1U5 GGGGCGCGCACCCGGAGCTGTGGACGGAGAGTGCCTNCCTCTGGCCTCAGTTTCCTCATG
RBdS040C07 pGCAP10 GAGTGGCGTGGCGTGGCGTGGCGTGGCGTGGCGGGGTCTCGCGGCGCGGGCGCGCACCCG
RBdS156G20 pGCAP10 GGTGNNNTGGCGTGGCGTGGCGTGGCGTGGCGGGGTCTCGCGGCGCGGGCGCGCACCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl