Prev. |  KEGG KO K03022 > 

RIKEN DNA Bank Human Resource - POLR3H

Gene ID NCBI Gene 171568 |  KEGG hsa:171568
Gene Symbol POLR3H
Protein Name RNA polymerase III subunit H
Synonyms RPC22.9|RPC8
Ortholog resources KEGG ortholog (KEGG orthology K03022) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY095815 IRAL039I23 pOTB7 BC017248 NM_138338 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048505 ARe21E09 pKA1U5 NM_138338.2  
GGCCCGCAGTCGCGCAAGCGCGAGCGGCTGTGCGCGGTGCGCGGTGCGCGGTGCGTGGTG
HKR058951 ARe47G07 pKA1U5 NM_138338.2  
GGGGCGCGCACCCGGAGCTGTGGACGGAGAGTGCCTNCCTCTGGCCTCAGTTTCCTCATG
HKR416055 RBdS040C07 pGCAP10 NM_138338.2  
GAGTGGCGTGGCGTGGCGTGGCGTGGCGTGGCGGGGTCTCGCGGCGCGGGCGCGCACCCG
HKR462564 RBdS156G20 pGCAP10 NM_138338.2  
GGTGNNNTGGCGTGGCGTGGCGTGGCGTGGCGGGGTCTCGCGGCGCGGGCGCGCACCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl