Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04898

HP ID(1) HP04898
Gene ID(2) 280636
Gene Symbol finder C11orf31
Protein Name chromosome 11 open reading frame 31
RefSeq NM_170746.2
Length of RefSeq (bp) 1294
Chromosome 11q12.1
Reference DDBJ accession
UniGene Hs.719147

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe18D06 pKA1U5 GGCTCTTCGTTGCCCAGTTTCCGCTCAGTGGTCGCGTCTCCGCCCCCCACCCACCAGTCC
ARe48G04 pKA1U5 GCCCTTCCTTTGAGAGAGGTTTCCGCTGTAGGAGCAGAGCTTCCGGGCTGCGCTCTTCGT
ARe79B06 pKA1U5 GGTAGGAGCAGAGCTTCCGGGCTGCGCTCTTCGTTGCCCAGTTTCCGCTCAGTGGTCGCG
ARe99C11 pKA1U5 ATCCTGTTTGAGAGCTTCCGGGCTGCGCCTCTTCGCNTGNCCAGCTTTCNGCTCAGGTGG
ARi32D08 pGCAP10 GAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGT
ARi33A05 pGCAP10 GATTTTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGTAAGGCTGAG
ARiS055C10 pGCAP10 GGTTGCCCAGTTTCCGCTCAGTGGTCGCGTCTCCGCCCCCCACCCACCAGTCCCGCTGCA
ARiS122I18 pGCAP10 GAGAGCTTCCGGGCTGCGCTCTTCGTTGCCCAGTTTCCGCTCAGTGGTCGCGTCTCCGCC
ARiS191J04 pGCAP10 GAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGT
RBb16D08 pKA1U5 GAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGT
RBb36E03 pGCAP1 GAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGT
RBb50D01 pGCAP1 GGTAGGNAGCAGAGCTTCCGGGCCTGCGCTCTTCGTTGCCCAGCTTTCCGCTCAGTTGGT
RBd05H05 pGCAP10 GAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGT
RBd40F02 pGCAP10 GAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGT
RBd65H11 pGCAP10 GAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGT
RBd69E02 pGCAP10 GCCCTTCCTTTGAGAGAGGTTTCCGCTGTAGGAGCAGAGCTTCCGGGCTGCGCTCTTCGT
RBd81B03 pGCAP10 GAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGT
RBd84A02 pGCAP10 GACCAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAG
RBdS015M07 pGCAP10 GACCCACCAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAG
RBdS104P16 pGCAP10 GAGAGCTTCCGGGCTGCGCTCTTCGTTGCCCAGTTTCCGCTCAGTGGTCGCGTCTCCGCC
RBdS105E13 pGCAP10 GAGGCGCCATGGCTCCCCGCGGGAGGAAGCGTAAGGCTGAGGCCGCGGTGGTCGCCGTAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl