Prev. | 

RIKEN DNA Bank Human Resource - SELENOH

Gene ID NCBI Gene 280636 |  KEGG hsa:280636
Gene Symbol SELENOH
Protein Name selenoprotein H
Synonyms C11orf31|C17orf10|SELH
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047278 ARe18D06 pKA1U5 NM_170746.2  
GGCTCTTCGTTGCCCAGTTTCCGCTCAGTGGTCGCGTCTCCGCCCCCCACCCACCAGTCC
HKR059348 ARe48G04 pKA1U5 NM_170746.2  
GCCCTTCCTTTGAGAGAGGTTTCCGCTGTAGGAGCAGAGCTTCCGGGCTGCGCTCTTCGT
HKR071630 ARe79B06 pKA1U5 NM_170746.2  
GGTAGGAGCAGAGCTTCCGGGCTGCGCTCTTCGTTGCCCAGTTTCCGCTCAGTGGTCGCG
HKR079659 ARe99C11 pKA1U5 NM_170746.2  
ATCCTGTTTGAGAGCTTCCGGGCTGCGCCTCTTCGCNTGNCCAGCTTTCNGCTCAGGTGG
HKR172880 ARi32D08 pGCAP10 NM_170746.2  
GAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGT
HKR173205 ARi33A05 pGCAP10 NM_170746.2  
GATTTTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGTAAGGCTGAG
HKR222058 ARiS055C10 pGCAP10 NM_170746.2  
GGTTGCCCAGTTTCCGCTCAGTGGTCGCGTCTCCGCCCCCCACCCACCAGTCCCGCTGCA
HKR249010 ARiS122I18 pGCAP10 NM_170746.2  
GAGAGCTTCCGGGCTGCGCTCTTCGTTGCCCAGTTTCCGCTCAGTGGTCGCGTCTCCGCC
HKR276620 ARiS191J04 pGCAP10 NM_170746.2  
GAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGT
HKR326480 RBb16D08 pKA1U5 NM_170746.2  
GAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGT
HKR334499 RBb36E03 pGCAP1 NM_170746.2  
GAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGT
HKR340073 RBb50D01 pGCAP1 NM_170746.2  
GGTAGGNAGCAGAGCTTCCGGGCCTGCGCTCTTCGTTGCCCAGCTTTCCGCTCAGTTGGT
HKR362173 RBd05H05 pGCAP10 NM_170746.2  
GAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGT
HKR376122 RBd40F02 pGCAP10 NM_170746.2  
GAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGT
HKR386179 RBd65H11 pGCAP10 NM_170746.2  
GAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGT
HKR387698 RBd69E02 pGCAP10 NM_170746.2  
GCCCTTCCTTTGAGAGAGGTTTCCGCTGTAGGAGCAGAGCTTCCGGGCTGCGCTCTTCGT
HKR392427 RBd81B03 pGCAP10 NM_170746.2  
GAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAGCGT
HKR393602 RBd84A02 pGCAP10 NM_170746.2  
GACCAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAGGAAG
HKR406295 RBdS015M07 pGCAP10 NM_170746.2  
GACCCACCAGTCCCGCTGCATTCTCGGCCGGGCTCTAGGCGCCATGGCTCCCCGCGGGAG
HKR441976 RBdS104P16 pGCAP10 NM_170746.2  
GAGAGCTTCCGGGCTGCGCTCTTCGTTGCCCAGTTTCCGCTCAGTGGTCGCGTCTCCGCC
HKR442109 RBdS105E13 pGCAP10 NM_170746.2  
GAGGCGCCATGGCTCCCCGCGGGAGGAAGCGTAAGGCTGAGGCCGCGGTGGTCGCCGTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl