Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04888

HP ID(1) HP04888
Gene ID(2) 23353
Gene Symbol finder UNC84A
Protein Name unc-84 homolog A (C. elegans)
RefSeq NM_025154.4
Length of RefSeq (bp) 3812
Chromosome 7p22.3
Reference DDBJ accession
UniGene Hs.438072

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe17E08 pKA1U5 GCTGGGCGGCGCAGACGAGGCCTGAGGCGGCGGCGCGAGGCAGTATGGTTTGAAGTGGTG
RBb35E03 pGCAP1 GAGACGAGGCCTGAAGGCGGCGGCGCGAGGCAGTATGGTTTGAAGTGGTGAACATGGATT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl