Prev. |  KEGG KO K19347 > 

RIKEN DNA Bank Human Resource - SUN1

Gene ID NCBI Gene 23353 |  KEGG hsa:23353
Gene Symbol SUN1
Protein Name Sad1 and UNC84 domain containing 1
Synonyms UNC84A
Ortholog resource in our bank

  SUN1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE040885 W01A102D13 pENTR-TOPO flj0031g18 AK022469 NM_025154  
HGE040889 W01A102D17 pENTR-TOPO flj0031g18 AK022469 NM_025154  
HGE040891 W01A102D19 pENTR-TOPO flj0031g18 AK022469 NM_025154  
HGE040893 W01A102D21 pENTR-TOPO flj0031g18 AK022469 NM_025154  
HGE040923 W01A102F03 pENTR-TOPO flj0031g18 AK022469 NM_025154  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046904 ARe17E08 pKA1U5 NM_025154.4  
GCTGGGCGGCGCAGACGAGGCCTGAGGCGGCGGCGCGAGGCAGTATGGTTTGAAGTGGTG
HKR334099 RBb35E03 pGCAP1 NM_025154.4  
GAGACGAGGCCTGAAGGCGGCGGCGCGAGGCAGTATGGTTTGAAGTGGTGAACATGGATT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl