Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04870

HP ID(1) HP04870
Gene ID(2) 27018
Gene Symbol finder NGFRAP1
Protein Name nerve growth factor receptor (TNFRSF16) associated protein 1
RefSeq NM_014380.1
Length of RefSeq (bp) 891
Chromosome Xq22.2
Reference DDBJ accession
UniGene Hs.719133

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe16E03 pKA1U5 ATCCTGGACTCGCGTCTGGCTACCAGCTCCCCGCTGCCCTGAGCTCGGCGGGCTGGCATT
ARe72C01 pKA1U5 GGTTTTTTGCGCGTGCATATGGCGGTGGCGGGTGGGGGGAAGGGGGAGATCCTGCTGCAC
ARe74D12 pKA1U5 GAGAGCTGCAGAGCGACGCAGCCTTCGGTGCAGTCGTCACTCGCGTCTGGCTACCAGCTC
ARe89A05 pKA1U5 ATCCTGTGACTCGCGTCTGGCTACCAGCTCCCCGCTGCCCTGAGCTCGGCGGGCTGGCAT
ARf04A06 pKA1U5 GACTCGCGTCTGGCTACCAGCTCCCCGCTGCCCTGAGCTCGGCGGGCTGGCATTCGGCCC
ARi25A04 pGCAP10 GGCTGCCCTGAGCTCGGCGGGCTGGCATTCGGCCCGGGGAAAAGCGGAGCAGGTCTGCGA
ARiS055J14 pGCAP10 GAGCTGCAGAGCGACGCAGCCTTCGGTGCAGTCGTCACTCGCGTCTGGCTACCAGCTCCC
ARiS085D01 pGCAP10 GAGCTCCCCGCTGCCCTGAGCTCGGCGGGCTGGCATTCGGCCCGGGGAAAAGCGGAGCAG
RBb66G05 pGCAP1 TTTGGTCACTCGCGTCTGGCTACCAGCTCCCCGCTGCCCTGAGCTCGGCGGGCTGGCATT
RBb66H05 pGCAP1 TTTGGTCACTCGCGTCTGGCTACCAGCTCCCCGCTGCCCTGAGCTCGGCGGGCTGGCATT
RBd89A06 pGCAP10 GGCCTTCGGTGCAGTCGTCACTCGCGTCTGGCTACCAGCTCCCCGCTGCCCTGAGCTCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl