Prev. |  KEGG KO K12465 > 

RIKEN DNA Bank Human Resource - BEX3

Gene ID NCBI Gene 27018 |  KEGG hsa:27018
Gene Symbol BEX3
Protein Name brain expressed X-linked 3
Synonyms Bex|DXS6984E|HGR74|NADE|NGFRAP1
Ortholog resources KEGG ortholog (KEGG orthology K12465) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY031082 IRAK077L18 pBluescriptR BC051713 NM_206917 Full
HGY082662 IRAL006K22 pOTB7 BC003190 NM_206917 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046499 ARe16E03 pKA1U5 NM_014380.1  
ATCCTGGACTCGCGTCTGGCTACCAGCTCCCCGCTGCCCTGAGCTCGGCGGGCTGGCATT
HKR068849 ARe72C01 pKA1U5 NM_014380.1  
GGTTTTTTGCGCGTGCATATGGCGGTGGCGGGTGGGGGGAAGGGGGAGATCCTGCTGCAC
HKR069684 ARe74D12 pKA1U5 NM_014380.1  
GAGAGCTGCAGAGCGACGCAGCCTTCGGTGCAGTCGTCACTCGCGTCTGGCTACCAGCTC
HKR075605 ARe89A05 pKA1U5 NM_014380.1  
ATCCTGTGACTCGCGTCTGGCTACCAGCTCCCCGCTGCCCTGAGCTCGGCGGGCTGGCAT
HKR081606 ARf04A06 pKA1U5 NM_014380.1  
GACTCGCGTCTGGCTACCAGCTCCCCGCTGCCCTGAGCTCGGCGGGCTGGCATTCGGCCC
HKR170004 ARi25A04 pGCAP10 NM_014380.1  
GGCTGCCCTGAGCTCGGCGGGCTGGCATTCGGCCCGGGGAAAAGCGGAGCAGGTCTGCGA
HKR222230 ARiS055J14 pGCAP10 NM_014380.1  
GAGCTGCAGAGCGACGCAGCCTTCGGTGCAGTCGTCACTCGCGTCTGGCTACCAGCTCCC
HKR234073 ARiS085D01 pGCAP10 NM_014380.1  
GAGCTCCCCGCTGCCCTGAGCTCGGCGGGCTGGCATTCGGCCCGGGGAAAAGCGGAGCAG
HKR346549 RBb66G05 pGCAP1 NM_014380.1  
TTTGGTCACTCGCGTCTGGCTACCAGCTCCCCGCTGCCCTGAGCTCGGCGGGCTGGCATT
HKR346573 RBb66H05 pGCAP1 NM_014380.1  
TTTGGTCACTCGCGTCTGGCTACCAGCTCCCCGCTGCCCTGAGCTCGGCGGGCTGGCATT
HKR395606 RBd89A06 pGCAP10 NM_014380.1  
GGCCTTCGGTGCAGTCGTCACTCGCGTCTGGCTACCAGCTCCCCGCTGCCCTGAGCTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl