Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04868

HP ID(1) HP04868
Gene ID(2) 91283
Gene Symbol finder C9orf30
Protein Name chromosome 9 open reading frame 30
RefSeq NM_080655.1
Length of RefSeq (bp) 1175
Chromosome 9q31.1
Reference DDBJ accession
UniGene Hs.530272

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe16D05 pKA1U5 GGGCGCTCGGGAGCCCGCGGCCCTCCCGGCCGCCCTGCTTGCGAGAGGAGCCCAGGCCGC
ARiS045K24 pGCAP10 TGGTAGAGGGGGCCGGGGGCCGGCATGGAGGGTTTTCGGGCCGAGCCGCTGCGACCCCGG
RBb50F12 pGCAP1 TGGCCCTCCCGGCCGCCCTGCTTGCGAGAGGAGCCCAGGCCGCCCGCCCTCGCGCCTCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl