Prev. | 

RIKEN DNA Bank Human Resource - MSANTD3

Gene ID NCBI Gene 91283 |  KEGG hsa:91283
Gene Symbol MSANTD3
Protein Name Myb/SANT DNA binding domain containing 3
Synonyms C9orf30|L8
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005133 IRAK012N21 pCMV-SPORT6 BC008993 NM_080655

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046477 ARe16D05 pKA1U5 NM_080655.1  
GGGCGCTCGGGAGCCCGCGGCCCTCCCGGCCGCCCTGCTTGCGAGAGGAGCCCAGGCCGC
HKR218264 ARiS045K24 pGCAP10 NM_080655.1  
TGGTAGAGGGGGCCGGGGGCCGGCATGGAGGGTTTTCGGGCCGAGCCGCTGCGACCCCGG
HKR340132 RBb50F12 pGCAP1 NM_080655.1  
TGGCCCTCCCGGCCGCCCTGCTTGCGAGAGGAGCCCAGGCCGCCCGCCCTCGCGCCTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl