Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04857

HP ID(1) HP04857
Gene ID(2) 192111
Gene Symbol finder PGAM5
Protein Name phosphoglycerate mutase family member 5
RefSeq NM_138575.2
Length of RefSeq (bp) 1213
Chromosome 12q24.33
Reference DDBJ accession
UniGene Hs.102558

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe15D11 pKA1U5 GGCGGGCCGGCGCGGGAGCAAGTGGCATGGCGTTCCGGCAGGCGCTGCAGCTGGCGGCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl