Prev. |  KEGG KO K15637 > 

RIKEN DNA Bank Human Resource - PGAM5

Gene ID NCBI Gene 192111 |  KEGG hsa:192111
Gene Symbol PGAM5
Protein Name PGAM family member 5, mitochondrial serine/threonine protein phosphatase
Synonyms BXLBV68
Ortholog resources KEGG ortholog (KEGG orthology K15637) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001287 IRAK003D15 pCMV-SPORT6 BC008196 NM_138575 Full
HGX042934 IRAK107F14 pCMV-SPORT6 BC047906 NM_138575 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE091602 M01C029A02 pDONR221 MGC04-B01 BC008196 ENST00000317555  
HGE091650 M01C029C02 pDONR221 MGC04-B01 BC008196 ENST00000317555  
HGE091698 M01C029E02 pDONR221 MGC04-B01 BC008196 ENST00000317555  
HGE091746 M01C029G02 pDONR221 MGC04-B01 BC008196 ENST00000317555  
HGE091794 M01C029I02 pDONR221 MGC04-B01 BC008196 ENST00000317555  
HGE091842 M01C029K02 pDONR221 MGC04-B01 BC008196 ENST00000317555  
HGE091890 M01C029M02 pDONR221 MGC04-B01 BC008196 ENST00000317555  
HGE091938 M01C029O02 pDONR221 MGC04-B01 BC008196 ENST00000317555  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046083 ARe15D11 pKA1U5 NM_138575.2  
GGCGGGCCGGCGCGGGAGCAAGTGGCATGGCGTTCCGGCAGGCGCTGCAGCTGGCGGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl