Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04853

HP ID(1) HP04853
Gene ID(2) 6919
Gene Symbol finder TCEA2
Protein Name transcription elongation factor A (SII), 2
RefSeq NM_003195.4
Length of RefSeq (bp) 1749
Chromosome 20q13.33
Reference DDBJ accession
UniGene Hs.505004

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe15A04 pKA1U5 GGCTGCGTCGGCTGCGGCGGGTGTGGGAGGTGGCGACGGCCGGGGCCGGGGTCCTGCCCG
RBd98G06 pGCAP10 GGCGGCGGGGCTGCGTCGGCTGCGGCGGGTGTGGGAGGTGGCGACGGCCGGGGCCGGGGT
RBdS081N15 pGCAP10 TGGGGGGGTCTGTCGTCCGCGGNGGGGCTGCGTCGGCTGCGGCGGGTGTGGGANGNGGNG
RBdS187E12 pGCAP10 GCGGCTGCGGAGGCGGGCGCGACGGGCGCGGGGGTCGCTGCTCCTGAGGCGATGATGGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl