Prev. |  KEGG KO K03145 > 

RIKEN DNA Bank Human Resource - TCEA2

Gene ID NCBI Gene 6919 |  KEGG hsa:6919
Gene Symbol TCEA2
Protein Name transcription elongation factor A2
Synonyms TFIIS
Ortholog resource in our bank

  TCEA2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044035 IRAK110B11 pCMV-SPORT6 BC050623 NM_198723 Full/var
HGX044335 IRAK110N23 pCMV-SPORT6 BC050624 NM_003195 Partial
HGX047623 IRAK119A23 pCMV-SPORT6 BC056407 NM_003195 Partial
HGY086258 IRAL015K18 pOTB7 BC018896 NM_198723 Full
HGY092377 IRAL030P17 pOTB7 BC014211 NM_003195 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE030672 W01A076L08 pENTR-TOPO flj0037p20 AK027824 NM_198723  
HGE030674 W01A076L10 pENTR-TOPO flj0037p20 AK027824 NM_198723  
HGE030676 W01A076L12 pENTR-TOPO flj0037p20 AK027824 NM_198723  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046004 ARe15A04 pKA1U5 NM_003195.4  
GGCTGCGTCGGCTGCGGCGGGTGTGGGAGGTGGCGACGGCCGGGGCCGGGGTCCTGCCCG
HKR399350 RBd98G06 pGCAP10 NM_003195.4  
GGCGGCGGGGCTGCGTCGGCTGCGGCGGGTGTGGGAGGTGGCGACGGCCGGGGCCGGGGT
HKR432727 RBdS081N15 pGCAP10 NM_003195.4  
TGGGGGGGTCTGTCGTCCGCGGNGGGGCTGCGTCGGCTGCGGCGGGTGTGGGANGNGGNG
HKR474908 RBdS187E12 pGCAP10 NM_003195.4  
GCGGCTGCGGAGGCGGGCGCGACGGGCGCGGGGGTCGCTGCTCCTGAGGCGATGATGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl