Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04851

HP ID(1) HP04851
Gene ID(2) 7326
Gene Symbol finder UBE2G1
Protein Name ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, yeast)
RefSeq NM_003342.4
Length of RefSeq (bp) 4208
Chromosome 17p13.2
Reference DDBJ accession
UniGene Hs.714345

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe14H02 pKA1U5 GGCCGAGCGGCCCTGCGCGCAGTGAGGCAGTGNCGTTNGGAAGGCACCGGTGGGGCCGAC
RBb15B07 pKA1U5 GGCGCAGTGAGGCAGTGGCGGGGGAAGGCACCGGCTGGGGCCGACGGGCGGGTTGAAGGA
RBb35C03 pGCAP1 GCCTTCCGGGCGTGAGTCGCTGTGAAAAGAGCTGAAGCGAGCGGACTCGCACCGGCAGCG
RBd33E08 pGCAP10 GAGCGCGCCTGCGCCGAGCGGCCCTGCGCGCAGTGAGGCAGTGGCGGGGGAAGGCACCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl