Prev. |  KEGG KO K10575 > 

RIKEN DNA Bank Human Resource - UBE2G1

Gene ID NCBI Gene 7326 |  KEGG hsa:7326
Gene Symbol UBE2G1
Protein Name ubiquitin conjugating enzyme E2 G1
Synonyms E217K|UBC7|UBE2G
Ortholog resources KEGG ortholog (KEGG orthology K10575) in the DNA Bank
Featured content Parkinson disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084891 IRAL012D19 pOTB7 BC002775 NM_182682 Full
HGY095149 IRAL037O13 pDNR-LIB BC026288 NM_182682 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045770 ARe14H02 pKA1U5 NM_003342.4  
GGCCGAGCGGCCCTGCGCGCAGTGAGGCAGTGNCGTTNGGAAGGCACCGGTGGGGCCGAC
HKR326031 RBb15B07 pKA1U5 NM_003342.4  
GGCGCAGTGAGGCAGTGGCGGGGGAAGGCACCGGCTGGGGCCGACGGGCGGGTTGAAGGA
HKR334051 RBb35C03 pGCAP1 NM_003342.4  
GCCTTCCGGGCGTGAGTCGCTGTGAAAAGAGCTGAAGCGAGCGGACTCGCACCGGCAGCG
HKR373304 RBd33E08 pGCAP10 NM_003342.4  
GAGCGCGCCTGCGCCGAGCGGCCCTGCGCGCAGTGAGGCAGTGGCGGGGGAAGGCACCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl