Prev. |  KEGG KO K10575 > 

RIKEN DNA Bank Human Resource - UBE2G1

Gene ID NCBI Gene 7326 |  KEGG hsa:7326
Gene Symbol UBE2G1
Protein Name ubiquitin conjugating enzyme E2 G1
Synonyms E217K|UBC7|UBE2G
Featured content Parkinson disease - human
Ortholog resource in our bank

  UBE2G1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011138 IRAK027O02 pCMV-SPORT6 BC017006
HGY084891 IRAL012D19 pOTB7 BC002775 NM_182682 Full
HGY095149 IRAL037O13 pDNR-LIB BC026288 NM_182682 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR045770 ARe14H02 pKA1U5 NM_003342.4  
GGCCGAGCGGCCCTGCGCGCAGTGAGGCAGTGNCGTTNGGAAGGCACCGGTGGGGCCGAC
HKR326031 RBb15B07 pKA1U5 NM_003342.4  
GGCGCAGTGAGGCAGTGGCGGGGGAAGGCACCGGCTGGGGCCGACGGGCGGGTTGAAGGA
HKR334051 RBb35C03 pGCAP1 NM_003342.4  
GCCTTCCGGGCGTGAGTCGCTGTGAAAAGAGCTGAAGCGAGCGGACTCGCACCGGCAGCG
HKR373304 RBd33E08 pGCAP10 NM_003342.4  
GAGCGCGCCTGCGCCGAGCGGCCCTGCGCGCAGTGAGGCAGTGGCGGGGGAAGGCACCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl