Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04847

HP ID(1) HP04847
Gene ID(2) 116447
Gene Symbol finder TOP1MT
Protein Name topoisomerase (DNA) I, mitochondrial
RefSeq NM_052963.1
Length of RefSeq (bp) 1923
Chromosome 8q24.3
Reference DDBJ accession
UniGene Hs.528574

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe14G03 pKA1U5 CCTTTCCCGGAGGCTGGCAGATGCGCGTGGTGCGGCTGCTGCGGCTCCGGGCGGCTCTGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl