Prev. |  KEGG KO K03163 > 

RIKEN DNA Bank Human Resource - TOP1MT

Gene ID NCBI Gene 116447 |  KEGG hsa:116447
Gene Symbol TOP1MT
Protein Name DNA topoisomerase I mitochondrial
Synonyms -
Ortholog resource in our bank

  TOP1MT

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020861 IRAK052C13 pCMV-SPORT6 BC027453 NM_052963 Partial
HGY097875 IRAL044L11 pOTB7 BC044646 NM_052963 Full/var
HGY098880 IRAL047D08 pOTB7 BC052285 NM_052963 Full/var
HGY103493 IRAL058M05 pOTB7 BC071914 NM_052963 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE112434 M01C081B10 pDONR221 IMS04-D05 BC052285 NM_052963  
HGE112482 M01C081D10 pDONR221 IMS04-D05 BC052285 NM_052963  
HGE112530 M01C081F10 pDONR221 IMS04-D05 BC052285 NM_052963  
HGE112578 M01C081H10 pDONR221 IMS04-D05 BC052285 NM_052963  
HGE112626 M01C081J10 pDONR221 IMS04-D05 BC052285 NM_052963  
HGE112674 M01C081L10 pDONR221 IMS04-D05 BC052285 NM_052963  
HGE112722 M01C081N10 pDONR221 IMS04-D05 BC052285 NM_052963  
HGE112770 M01C081P10 pDONR221 IMS04-D05 BC052285 NM_052963  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR045747 ARe14G03 pKA1U5 NM_052963.1  
CCTTTCCCGGAGGCTGGCAGATGCGCGTGGTGCGGCTGCTGCGGCTCCGGGCGGCTCTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl